Search Thermo Fisher Scientific
Oligonucleotides
Explore a comprehensive selection of oligonucleotides, including primers and probes. These short DNA or RNA molecules find applications in various research areas like microarrays, gel shift assays, gene synthesis, PCR, DNA sequencing, molecular cloning, and forensics. Oligonucleotides are available in different lengths, either pre-designed, customized, or randomized. Learn more about oligonucleotides.
Products (686)
Learn More (0)
Documents & Support
(0)686 Products
Filter
Product | Concentration | For Use With (Equipment) | Primer | Size | Price | |
|---|---|---|---|---|---|---|
| 10 μM | — | pJET | 10 µM | |||
| 10 μM | — | pJET | 10 µM | |||
| 500 μM | — | Random | 100 µL | |||
| 0.2 μg/μL | — | Random Hexamer | 120 µL | |||
| 10 μM | — | T3 | 10 µM | |||
| 10 μM | — | T3 | 10 µM | |||
| 10 μM | — | T7 | 10 µM | |||
| 10 μM | — | SP6 | 10 µM | |||
| 10 μM | — | SP6 | 10 µM | |||
| 10 μM | — | M13 | 10 µM | |||
| 10 μM | — | M13 | 10 µM | |||
| 10 μM | — | M13 | 10 µM | |||
| 10 μM | — | M13 | 10 µM | |||
| 10 μM | — | M13 | 10 µM | |||
| — | — | Digoxigenin Labeled | 1 mL | |||
| — | — | — | 1 mL | |||
| — | — | — | 1 mL | |||
| 50 μM | — | Oligo dT | 5 nmol | |||
| 50 μM | — | Random Hexamer | 5 nmol | |||
| — | — | T7 | 2 μg | |||
| — | — | M13 | 2 μg | |||
| — | — | M13 | 2 μg | |||
| 10 mM | — | — | 25 µL | |||
| 75 mM | — | — | 30 µL | |||
| 10 mM | — | — | 25 µL | |||
| 50 mM | — | — | 50 µl | |||
| 0.5 mg/mL | — | — | 200 µg | |||
| 50 μM | — | Random | 80 µL | |||
| 50 μM | — | Random | 80 µL | |||
| — | — | Digoxigenin Labeled | 1 mL |
pJET1.2 Reverse Sequencing Primer, 24-mer Thermo Scientific™
Product Type: Forward Sequencing Primer. Shipping Condition: Dry Ice. Concentration: 10 μM. Primer: pJET.
pJET1.2 Forward Sequencing Primer, 23-mer Thermo Scientific™
Product Type: Forward Sequencing Primer. Shipping Condition: Dry Ice. Concentration: 10 μM. Primer: pJET.
Exo-Resistant Random Primer Thermo Scientific™
Product Type: Primer. Shipping Condition: Dry Ice. Concentration: 500 μM. Primer: Random.
Random Hexamer Primer Thermo Scientific™
Product Type: Primer. Shipping Condition: Dry Ice. Concentration: 0.2 μg/μL Primer: Random Hexamer.
T3 promoter Sequencing Primer, 24-mer Thermo Scientific™
Promoter: SP6. Promoter: T3. Promoter: T7. Product Type: Sequencing Primer.
T3 promoter Sequencing Primer, 17-mer Thermo Scientific™
Promoter: SP6. Promoter: T3. Promoter: T7. Product Type: Sequencing Primer.
T7 promoter Sequencing Primer, 20-mer Thermo Scientific™
Promoter: SP6. Promoter: T3. Promoter: T7. Product Type: Sequencing Primer.
SP6 promoter Sequencing Primer, 24-mer Thermo Scientific™
Promoter: SP6. Promoter: T3. Promoter: T7. Product Type: Sequencing Primer.
SP6 promoter Sequencing Primer, 18-mer Thermo Scientific™
Promoter: SP6. Promoter: T3. Promoter: T7. Product Type: Sequencing Primer.
M13/pUC Reverse Sequencing Primer (-46), 24-mer Thermo Scientific™
Product Type: Sequencing Primer. Shipping Condition: Dry Ice. Concentration: 10 μM. Primer: M13.
M13/pUC Sequencing Primer (-46), 22-mer Thermo Scientific™
Product Type: Sequencing Primer. Shipping Condition: Dry Ice. Concentration: 10 μM. Primer: M13.
M13/pUC Sequencing Primer (-40), 17-mer Thermo Scientific™
Product Type: Sequencing Primer. Shipping Condition: Dry Ice. Concentration: 10 μM. Primer: M13.
M13/pUC Reverse Sequencing Primer (-26), 17-mer Thermo Scientific™
Product Type: Sequencing Primer. Shipping Condition: Dry Ice. Concentration: 10 μM. Primer: M13.
M13/pUC sequencing primer (-20), 17-mer Thermo Scientific™
Product Type: Sequencing Primer. Shipping Condition: Dry Ice. Concentration: 10 μM. Primer: M13.
Digoxigenin-labeled RNA Positive Control Oligonucleotides (Poly-A) Thermo Scientific™
Product Type: Oligonucleotides. Shipping Condition: Wet Ice. Label or Dye: Digoxigenin. Primer: Digoxigenin Labeled.
Biotinylated RNA Positive Control Oligonucleotides (Poly-A) Thermo Scientific™
Product Type: Oligonucleotides. Shipping Condition: Wet Ice. Label or Dye: Biotin. Quantity: 1 mL.
Biotinylated Positive Control Oligo Probe (ALU) Thermo Scientific™
Product Type: Oligonucleotides. Shipping Condition: Wet Ice. Label or Dye: Biotin. Quantity: 1 mL.
Oligo d(T)16 (50 μM) Invitrogen™
Product Type: Primer. Purification Method: Reverse Phase HPLC. Shipping Condition: Dry Ice. Concentration: 50 μM.
Random Hexamers (50 μM) Invitrogen™
Product Type: Primer. Shipping Condition: Dry Ice. Concentration: 50 μM. Primer: Random Hexamer.
T7 Promoter Primer Invitrogen™
Promoter: T7. Product Type: Primer. Primer Length: 20-mer. Primer Sequence: 5 ́d[TAATACGACTCACTATAGGG]3 ́.
M13 Reverse Primer Invitrogen™
Product Type: Primer. Primer Length: 17-mer. Primer Sequence: 5 ́d[CAGGAAACAGCTATGAC]3 ́. Purification Method: Desalted, Gel Filtration Purified.
M13 Forward (-20) Primer Invitrogen™
Product Type: Primer. Primer Length: 16-mer. Primer Sequence: 5 ́d[GTAAAACGACGGCCAG]3 ́. Purification Method: Desalted, Gel Filtration Purified.
Bio-16-UTP (10 mM) Invitrogen™
Product Type: Nucleotides. Labeling Method: RNA Labeling. Shipping Condition: Dry Ice. Concentration: 10 mM.
Bio-11-UTP (75 mM) Invitrogen™
Product Type: Nucleotides. Shipping Condition: Dry Ice. Concentration: 75 mM. Label or Dye: Biotin.
Bio-11-UTP (10 mM) Invitrogen™
Product Type: Nucleotides. Shipping Condition: Dry Ice. Concentration: 10 mM. Label or Dye: Biotin.
5-(3-Aminoallyl)-UTP (50 mM) Invitrogen™
Product Type: Nucleotides. Shipping Condition: Dry Ice. Concentration: 50 mM. Label or Dye: Aminoallyl.
Lambda Hind III dsDNA Markers Invitrogen™
Product Type: DNA Marker. Gel Compatibility: Agarose Gels. Shipping Condition: Room Temperature. Size Range: 125 to 23.1 kb
Oligo (dT) Primer (50 μM) Invitrogen™
Product Type: Primer. Shipping Condition: Dry Ice. Concentration: 50 μM. Primer: Random.
Random Decamers (50 μM) Invitrogen™
Product Type: Primer. Shipping Condition: Dry Ice. Concentration: 50 μM. Primer: Random.
Digoxigenin Labeled Oligonucleotides for EBER Thermo Scientific™
Product Type: Oligonucleotides. Probe Classification: Viral Genome Detection Probe. Shipping Condition: Wet Ice. Target Organism Class: Epstein-Barr Virus (EBV).